Aurora B (AURKB) (NM_001256834) Human Untagged Clone

CAT#: SC332487

AURKB (untagged) - Homo sapiens aurora kinase B (AURKB), transcript variant 2


  "NM_001256834" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AURKB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AURKB
Synonyms AIK2; AIM-1; AIM1; ARK-2; ARK2; AurB; aurkb-sv1; aurkb-sv2; IPL1; PPP1R48; STK-1; STK5; STK12
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256834, the custom clone sequence may differ by one or more nucleotides


ATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACAC
CCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTT
TGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCC
CAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATC
CCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCC
CCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATG
GAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAA
ATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCT
GAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAAT
GAGAAGGTGGATCTGTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGA
GTGCATCACACAACGAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCCGTGCCCAT
GGGAGCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTC
TCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAATCTGTCGCCT
GA


Restriction Sites SgfI-MluI     
ACCN NM_001256834
ORF Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256834.1, NP_001243763.1
RefSeq Size 1224
RefSeq ORF 912
Locus ID 9212
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Gene Summary This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region, which results in translation initiation from an in-frame downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 5 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.