RNF34 (NM_001256858) Human Untagged Clone

CAT#: SC332490

RNF34 (untagged) - Homo sapiens ring finger protein 34, E3 ubiquitin protein ligase (RNF34), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RNF34
• Synonyms: CARP-1; CARP1; hRFI; RFI; RIF; RIFF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256858, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGGAGAGCTTATGGATGGAGACCAAACATCCAGATCTGGAGTGCCGGCACAGGTACAAAGTGAAA
  TCACTTCAGCAAACACAGAAGATGATGATGACGACGATGATGAGGATGATGATGATGAAGAAGAAAACGC
  AGAGGATCGGAACCCCGGGCTCTCCAAGGAGAGAGTGAGAGCTTCACTGTCTGACTTGTCAAGCCTTGAT
  GATGTGGAAGGAATGAGCGTGCGCCAGCTGAAGGAAATTCTGGCTCGGAATTTTGTCAACTATTCTGGCT
  GTTGTGAAAAATGGGAACTGGTAGAGAAAGTAAACCGGTTATACAAAGAGAATGAAGAAAACCAAAAGTC
  CTATGGCGAGCGGCTGCAGCTGCAGGATGAGGAAGACGACAGCCTGTGTCGCATCTGCATGGATGCCGTC
  ATCGACTGTGTCCTACTGGAGTGTGGGCACATGGTTACCTGCACCAAGTGCGGCAAGCGCATGAGTGAGT
  GTCCCATCTGCCGGCAGTATGTGGTGCGAGCCGTGCACGTGTTCAAGTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256858
• ORF Size: 543 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256858.1, NP_001243787.1
• RefSeq Size: 1479
• RefSeq ORF: 543
• Locus ID: 80196
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene contains a RINF finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein interacts with DNAJA3/hTid-1, which is a DnaJ protein reported to function as a modulator of apoptosis. Overexpression of this gene in Hela cells was shown to confer the resistance to TNF-alpha induced apoptosis, suggesting an anti-apoptotic function of this protein. This protein can be cleaved by caspase-3 during the induction of apoptosis. This protein also targets p53 and phospho-p53 for degradation. Alternatively splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (3) has multiple differences in the 5' coding region which results in the use of an alternate translational start codon, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to variant 1.