NDUFB3 (NM_001257102) Human Untagged Clone

CAT#: SC332503

NDUFB3 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa (NDUFB3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFB3
• Synonyms: B12; CI-B12; MC1DN25
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001257102, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCATGAACATGGACATGAGCATGGACATCATAAAATGGAACTTCCAGATTATAGACAATGGAAGA
  TAGAAGGGACACCATTAGAAACTATCCAGAAGAAGCTGGCTGCAAAAGGGCTAAGGGATCCATGGGGCCG
  CAATGAAGCTTGGAGATACATGGGTGGCTTTGCAAAGAGTGTTTCCTTTTCTGATGTATTCTTTAAAGGA
  TTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACCTGGAGTCCCTGAATAAAG
  ATAAGAAGCATCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001257102
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001257102.1, NP_001244031.1
• RefSeq Size: 793 bp
• RefSeq ORF: 297 bp
• Locus ID: 4709
• Cytogenetics: 2q33.1
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]'
  Transcript Variant: This variant (2) represents the longer transcript. Variants 1 and 2 encode the same protein.