Spermine synthase (SMS) (NM_001258423) Human Untagged Clone
CAT#: SC332702
SMS (untagged) - Homo sapiens spermine synthase (SMS), transcript variant 2
"NM_001258423" in other vectors (2)
Product Images
Other products for "SMS"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SMS |
Synonyms | MRSR; SPMSY; SpS; SRS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001258423, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAGCACGGCACAGCACGCTCGACTTCATGCTCGGCGCCAAAGCTGATGGTGAGACCATTCTAA AAGGCCTCCAGTCCATTTTCCAGGAGCAGGGGATGGCGGAGTCGGTGCACACCTGGCAGGACCATGGCTA TTTAGCAACCTACACAAACAAGAACGGCAGATTACCACCCATAGTGCGAGGAGGAGCCATCGACAGATAC TGGCCCACCGCCGACGGGCGCCTGGTTGAATATGACATAGATGAAGTGGTATATGACGAAGATTCACCTT ATCAAAATATAAAAATTCTACACTCGAAGCAGTTTGGAAATATTCTCATCCTTAGTGGGGATGTTAATTT GGCAGAGAGTGATTTGGCATATACCCGGGCCATCATGGGCAGTGGCAAAGAAGATTACACTGGCAAAGAT GTACTCATTCTGGGAGGTGGAGACGGAGGCATATTGTGTGAAATAGTCAAACTAAAACCAAAGATGGTCA CTATGGTAGAGATTGACCAAATGGTGATTGATGGGTGTAAGAAATACATGCGAAAAACGTGTGGCGATGT CTTAGACAATCTTAAAGGAGACTGCTATCAGGTTCTAATAGAAGACTGTATCCCGGTACTGAAGAGGTAC GCCAAAGAAGGGAGAGAATTTGATTATGTGATTAATGATTTGACAGCTGTTCCAATCTCCACGTCTCCAG AAGAAGATTCCACATGGGAGTTTCTCAGACTGATTCTTGACCTCTCAATGAAAGTGTTGAAACAGGATGG GAAATATTTTACACAGGGGAACTGTGTCAATCTGACAGAAGCACTGTCGCTCTATGAAGAACAGCTGGGG CGCCTGTATTGTCCTGTGGAATTTTCAAAGGAGATCGTCTGTGTCCCTTCATACTTGGAATTGTGGGTAT TTTACACTGTTTGGAAGAAAGCTAAACCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258423 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001258423.1, NP_001245352.1 |
RefSeq Size | 1680 bp |
RefSeq ORF | 942 bp |
Locus ID | 6611 |
Cytogenetics | Xp22.11 |
Protein Pathways | Arginine and proline metabolism, beta-Alanine metabolism, Cysteine and methionine metabolism, Glutathione metabolism, Metabolic pathways |
Gene Summary | 'This gene encodes a protein belonging to the spermidine/spermin synthase family and catalyzes the production of spermine from spermidine. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene cause an X-linked intellectual disability called Snyder-Robinson Syndrome (SRS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]' Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.