P2RX4 (NM_001261397) Human Untagged Clone

CAT#: SC332756

P2RX4 (untagged) - Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), transcript variant 5


  "NM_001261397" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "P2RX4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol P2RX4
Synonyms P2X4; P2X4R
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001261397, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGCTGCTGCGCCGCGCTGGCGGCCTTCCTGTTCGAGTACGACACGCCGCGCATCGTGCTCATCC
GCAGCCGCAAAGTGGGGCTCATGAACCGCGCCGTGCAACTGCTCATCCTGGCCTACGTCATCGGGTGGGT
GTTTGTGTGGGAAAAGGGCTACCAGGAAACTGACTCCGTGGTCAGCTCCGTTACGACCAAGGTCAAGGGC
GTGGCTGTGACCAACACTTCTAAACTTGGATTCCGGATCTGGGATGTGGCGGATTATGTGATACCAGCTC
AGGAGGAAAACTCCCTCTTCGTCATGACCAACGTGATCCTCACCATGAACCAGACACAGGGCCTGTGCCC
CGAGATTCCAGATGCGACCACTGTGTGTAAATCAGATGCCAGCTGTACTGCCGGCTCTGCCGGCACCCAC
AGCAACGGAGTCTCAACAGGCAGACCTGCTTTTTTAAAGGCTGCAGAAAACTTCACTCTTTTGGTTAAGA
ACAACATCTGGTATCCCAAATTTAATTTCAGCAAGAGGAATATCCTTCCCAACATCACCACTACTTACCT
CAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATTCCGTCTTGGCAAAATAGTGGAG
AACGCAGGACACAGTTTCCAGGACATGGCCGTGGAGGGAGGCATCATGGGCATCCAGGTCAACTGGGACT
GCAACCTGGACAGAGCCGCCTCCCTCTGCTTGCCCAGGTACTCCTTCCGCCGCCTCGATACACGGGACGT
TGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGGCTGGCAACGAG
CAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGCAGGGAAATTTG
ACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCGACCGTGCTGTGTGA
CATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATATAAATATGTGGAAGAT
TACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001261397
ORF Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001261397.1, NP_001248326.1
RefSeq Size 2023
RefSeq ORF 1086
Locus ID 5025
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (5) lacks an in-frame exon in the 5' coding region and an in-frame segment in the central coding region, compared to variant 1. The resulting isoform (3) lacks two internal segments, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.