PRB4 (NM_001261399) Human Untagged Clone
CAT#: SC332757
PRB4 (untagged) - Homo sapiens proline-rich protein BstNI subfamily 4 (PRB4), transcript variant 2
"NM_001261399" in other vectors (2)
Product Images
Other products for "PRB4"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRB4 |
Synonyms | Po |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001261399, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTGATTCTGCTGTCAGTGGCCCTGCTGGCCCTGAGCTCAGCTGAGAGTTCAAGTGAAGATGTCA GCCAGGAAGAATCTCTCTTCCTAATATCAGGAAAGCCAGAAGGACGACGCCCACAAGGAGGAAACCAGCC CCAACGTCCCCCACCTCCTCCAGGAAAGCCACAAGGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGT CCCCCACCTCCTCCAGGAAAGCCAGAAGGACGACCCCCACAAGGAGGCAACCAGTCCCAAGGTCCCCCAC CTCATCCAGGAAAGCCAGAAAGACCACCCCCACAAGGAGGAAACCAGTCCCAAGGAAAGCCACAAGGACC ACCCCAACAAGAAGGCAACAAGCCTCAAGGTCCCCCACCTCCTGGAAAGCCACAAGGCCCACCCCCAGCA GGAGGCAATCCCCAGCAGCCTCAGGCACCTCCTGCTGGAAAGCCCCAGGGGCCACCTCCACCTCCTCAAG GGGGCAGGCCACCCAGACCTGCCCAGGGACAACAGCCTCCCCAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261399 |
ORF Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001261399.1, NP_001248328.1 |
RefSeq Size | 740 |
RefSeq ORF | 537 |
Locus ID | 5545 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. Multiple alleles of this gene exhibiting variations in the length of the tandem repeats have been identified. The reference genome encodes the "Small" allele. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter, compared to isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.