IL1 Receptor II (IL1R2) (NM_001261419) Human Untagged Clone

CAT#: SC332768

IL1R2 (untagged) - Homo sapiens interleukin 1 receptor, type II (IL1R2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL1R2
• Synonyms: CD121b; CDw121b; IL-1R-2; IL-1RT-2; IL-1RT2; IL1R2c; IL1RB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261419, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGCGCTTGTACGTGTTGGTAATGGGAGTTTCTGCCTTCACCCTTCAGCCTGCGGCACACACAGGGG
  CTGCCAGAAGCTGCCGGTTTCGTGGGAGGCATTACAAGCGGGAGTTCAGGCTGGAAGGGGAGCCTGTAGC
  CCTGAGGTGCCCCCAGGTGCCCTACTGGTTGTGGGCCTCTGTCAGCCCCCGCATCAACCTGACATGGCAT
  AAAAATGACTCTGCTAGGACGGTCCCAGGAGAAGAAGAGACACGGATGTGGGCCCAGGACGGTGCTCTGT
  GGCTTCTGCCAGCCTTGCAGGAGGACTCTGGCACCTACGTCTGCACTACTAGAAATGCTTCTTACTGTGA
  CAAAATGTCCATTGAGCTCAGAGTTTTTGAGAATACAGATGCTTTCCTGCCGTTCATCTCATACCCGCAA
  ATTTTAACCTTGTCAACCTCTGGGGTATTAGTATGCCCTGACCTGAGTGAATTCACCCGTGACAAAACTG
  ACGTGAAGATTCAATGGTACAAGGATTCTCTTCTTTTGGATAAAGACAATGAGAAATTTCTAAGTGTGAG
  GGGGACCACTCACTTACTCGTACACGATGTGGCCCTGGAAGATGCTGGCTATTACCGCTGTGTCCTGACA
  TTTGCCCATGAAGGCCAGCAATACAACATCACTAGGAGTATTGAGCTACGCATCAAGAAAAAAAAAGAAG
  AGACCATTCCTGTGATCATTTCCCCCCTCAAGACCATATCAGCTTCTCTGGGGTCAAGACTGACAATCCC
  GTGTAAGGTGTTTCTGGGAACCGGCACACCCTTAACCACCATGCTGTGGTGGACGGCCAATGACACCCAC
  ATAGAGAGCGCCTACCCGGGAGGCCGCGTGACCGAGGGGCCACGCCAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261419
• ORF Size: 891 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001261419.1, NP_001248348.1
• RefSeq Size: 1204
• RefSeq ORF: 891
• Locus ID: 7850
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, MAPK signaling pathway
• Gene Summary: The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (3) lacks multiple 3' exons and has an alternate 3' splice site which introduces an immediate stop codon, compared to variant 1. The encoded protein (isoform 2) has a shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.