alpha Tubulin (TUBA1A) (NM_001270400) Human Untagged Clone

CAT#: SC332921

TUBA1A (untagged) - Homo sapiens tubulin, alpha 1a (TUBA1A), transcript variant 3


  "NM_001270400" in other vectors (2)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "TUBA1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TUBA1A
Synonyms B-ALPHA-1; LIS3; TUBA3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270400, the custom clone sequence may differ by one or more nucleotides


ATGCCAAGTGACAAGACCATTGGGGGAGGAGATGATTCCTTCAACACCTTCTTCAGTGAGACGGGGGCTG
GCAAGCATGTGCCCCGGGCAGTGTTTGTAGACTTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCAC
CTACCGCCAGCTCTTCCACCCTGAGCAACTTATCACAGGCAAAGAAGATGCTGCCAATAACTATGCCCGA
GGGCACTACACCATTGGCAAGGAGATCATTGACCTCGTGTTGGACCGAATTCGCAAGCTGGCCGACCAGT
GCACGGGTCTCCAGGGCTTCTTGGTTTTCCACAGCTTTGGTGGGGGAACTGGTTCTGGGTTCACCTCGCT
GCTCATGGAACGTCTCTCAGTTGATTATGGCAAGAAGTCCAAGCTGGAGTTCTCTATTTACCCGGCGCCC
CAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCCACACCACCCTGGAGCACTCTG
ATTGTGCCTTCATGGTAGACAATGAGGCCATCTATGACATCTGTCGTAGAAACCTCGATATTGAGCGTCC
AACCTATACTAACCTGAATAGGTTAATAGGTCAAATTGTGTCCTCCATCACTGCTTCCCTGAGATTTGAT
GGAGCCCTGAATGTTGACCTGACAGAATTCCAGACCAACCTGGTGCCCTATCCCCGCATCCACTTCCCTC
TGGCCACATATGCCCCTGTCATCTCTGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCAGAGATCAC
CAATGCTTGCTTTGAGCCAGCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGC
TGCCTGTTGTACCGTGGTGACGTGGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAGACCAAGC
GTACCATCCAGTTTGTGGATTGGTGCCCCACTGGCTTCAAGGTTGGCATCAACTACCAGCCTCCCACTGT
GGTGCCTGGTGGAGACCTGGCCAAGGTACAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCT
GAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAACGTGCCTTTGTTCACTGGTACG
TTGGGGAGGGGATGGAGGAAGGTGAGTTTTCAGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTA
TGAGGAGGTTGGTGTGGATTCTGTTGAAGGAGAGGGTGAGGAAGAAGGAGAGGAATACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270400
ORF Size 1251 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270400.1, NP_001257329.1
RefSeq Size 2018
RefSeq ORF 1251
Locus ID 7846
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (3) contains an alternate segment at its 5' end which results in the use of an in-frame downstream start codon, compared to variant 1. This variant encodes a protein (isoform 2) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.