CFC1 (NM_001270420) Human Untagged Clone
CAT#: SC332927
CFC1 (untagged) - Homo sapiens cripto, FRL-1, cryptic family 1 (CFC1), transcript variant 2
"NM_001270420" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "CFC1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CFC1 |
Synonyms | CFC1B; CRYPTIC; DTGA2; HTX2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270420, the custom clone sequence may differ by one or more nucleotides
ATGACCTGGAGGCACCATGTCAGGCTTCTGTTTACGGTCAGTTTGGCATTACAGATCATCAATTTGGGAA ACAGCTATCAAAGAGAGAAACATAACGGCGGTAGAGAGGAAGTCACCAAGGTTGCCACTCAGAAGCACCG ACAGTCACCGCTCAACTGGACCTCCAGTCATTTCGGAGAGGTGACTGGGAGCGCCGAGGGCTGGGGGCCG GAGGAGCCGCTCCCCTACTCCCGGGCTTTCGGAGAGGTGAATGCGGCGCCCTGGAGCACGGAGCCTGGAC CCTCCGCGCCTGCCACCTCTGCAGGTGCATCTTCGGGGCCCTGCACTGCCTCCCCCTCCAGACGCCTGAC CGCTGTGACCCGAAAGACTTCCTGGCCTCCCACGCTCACGGGCCGAGCGCCGGGGGCGCGCCCAGCCTGC TACTCTTGCTGCCCTGCGCACTCCTGCACCGCCTCCTGCGCCCGGATGCGCCCGCGCACCCTCGGTCCCT GGTCCCTTCCGTCCTCCAGCGGGAGCGGCGCCCCTGCGGAAGGCCGGGACTTGGGCATCGCCTTTAATTT TCTATGTTGTAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270420 |
ORF Size | 576 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270420.1, NP_001257349.1 |
RefSeq Size | 1562 |
RefSeq ORF | 576 |
Locus ID | 55997 |
Gene Summary | This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.