RTBDN (NM_001270444) Human Untagged Clone

CAT#: SC332936

RTBDN (untagged) - Homo sapiens retbindin (RTBDN), transcript variant 7


  "NM_001270444" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RTBDN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RTBDN
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270444, the custom clone sequence may differ by one or more nucleotides


ATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACGTGGGTGCTGCAACTGACCTTGGCATGGATCC
TGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCCAGGTCCCAGCAACACCATGGGCTGGCAGCTGA
TCTGGGCAAAGGCAAGCTGCACCTGGCAGGACCTTGTTGTCCCTCAGAGATGGACACAACAGAGACATCG
GGCCCTGGAAACCATCCAGAACGCTGTGGAGTGCCGAGCCCTGAATGCGAATCCTTCCTGGAACACCTCC
AACGTGCCCTTCGCAGTCGCTTCCGCCTGCGGCTATTGGGGGTACGCCAGGCACAGCCGCTCTGCGAGGA
GCTCTGCCAGGCCTGGTTCGCCAACTGCGAAGATGATATCACCTGCGGCCCGACTTGGCTCCCACTCTCA
GAAAAAAGGGGCTGTGAGCCCAGCTGCCTTACCTATGGACAGACCTTCGCAGACGGGACGGACCTTTGTC
GCTCGGCTCTGGGCCACGCCCTACCGGTGGCTGCTCCTGGAGCCCGTCACTGCTTCAACATCTCCATCTC
CGCGGTACCTCGTCCCAGACCAGGACGACGGGGCCGGGAAGCTCCCTCCCGGCGTTCCCGCAGCCCTCGC
ACCTCCATCCTGGACGCTGCGGGCAGCGGGAGTGGCAGTGGAAGCGGCAGCGGCCCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270444
ORF Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270444.1, NP_001257373.1
RefSeq Size 1006
RefSeq ORF 690
Locus ID 83546
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (7) differs in the 5' UTR, compared to variant 1. Variants 1, 6 and 7 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.