UBE3B (NM_001270451) Human Untagged Clone

CAT#: SC332942

UBE3B (untagged) - Homo sapiens ubiquitin protein ligase E3B (UBE3B), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE3B
• Synonyms: BPIDS; KOS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270451, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCACCCTGTCTCAGACCTCGAGAGCATGGTTCATCGATAGAGCCCGTCAGGCACGAGAAGAAAGGC
  TTGTGCAGAAGGAACGGGAGCGGGCAGCTGTTGTGATCCAGGCCCATGTCCGGAGTTTTCTCTGTCGGAG
  TCGACTGCAGAGAGATATCAGGAGAGAGATTGATGACTTTTTTAAAGCAGATGACCCTGAGTCCACTAAA
  AGAAGTGCACTTTGTATTTTCAAGATTGCCAGGAAACTGCTGTTCCTATTCAGAATCAAAGAGGATAATG
  AGAGATTTGAGAAGTTGTGTCGCAGCATCCTGAGCAGCATGGATGCTGAGAATGAGCCTAAGGTGTGGTA
  TGTGTCCCTGGCTTGTTCTAAGGACCTCACCCTCCTTTGGATTCAACAGATCAAGAACATTTTGTGGTAC
  TGCTGTGATTTTCTCAAGCAGCTCAAGCCTGAAATCCTGCAGGACTCCCGACTCATCACCCTGTACCTCA
  CGATGCTTGTCACCTTCACAGACACTTCAACGTGGAAAATTCTTCGGGGAAAAGGTGAAAGTCTTCGACC
  AGCGATGAACCACATTTGTGCAAATATAATGGGACATCTCAACCAGCATGGATTTTATTCTGTGCTGCAG
  TGCTGTGATGGGCTGTTTCCTGATTTGGTTTCATATGCTCCTCACAACAACCCTGTGAGGTGGTCCGTTG
  GCAGAAGCTGGTATGACTGGCAGTTGTCTCGCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270451
• ORF Size: 735 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270451.1, NP_001257380.1
• RefSeq Size: 1158
• RefSeq ORF: 735
• Locus ID: 89910
• Protein Families: Druggable Genome
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (6) uses an alternate splice site in the 5' UTR and contains an alternate 3' exon, compared to variant 1. These differences result in a distinct 3' UTR and 3' coding region and a protein (isoform 3) with a shorter and distinct C-terminus, compared to isoform 1. Variants 4-6 encode the same protein (isoform 3).