TAF11 (NM_001270488) Human Untagged Clone
CAT#: SC332958
TAF11 (untagged) - Homo sapiens TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa (TAF11), transcript variant 2
"NM_001270488" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAF11 |
Synonyms | MGC:15243; PRO2134; TAF2I; TAFII28 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270488, the custom clone sequence may differ by one or more nucleotides
ATGGACGATGCCCACGAGTCGCCCTCCGACAAAGGTGGAGAGACAGGGGAGTCGGATGAGACGGCCGCTG TGCCCGGGGACCCGGGGGCTACCGACACCGATGGAATCCCAGAGGAAACTGACGGAGACGCAGATGTGGA CTTGAAAGAAGCTGCAGCGGAGGAAGGCGAGCTCGAGAGTCAGGATGTCTCAGATTTAACAACAGTTGAA AGGGAAGACTCATCATTACTTAATCCTGCAGCCAAAAAACTGAAAATAGATACCAAAGAAAAGAAAGAGA AAAAGCAGAAAGTAGATGAAGATGAGATTCAGAAGATGCAAATCCTGGTTTCTTCTTTTTCTGAGGAGCA GCTGAACCGTTATGAAATGTATCGCCGCTCAGCTTTCCCTAAGGCAGCCATCAAAAGGCACTGGATGTGT GTGAGAAGTGGGGAGAAATGCCACCACTACAACCCAAACATATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270488 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270488.1, NP_001257417.1 |
RefSeq Size | 1490 bp |
RefSeq ORF | 465 bp |
Locus ID | 6882 |
Cytogenetics | 6p21.31 |
Protein Families | Transcription Factors |
Protein Pathways | Basal transcription factors |
Gene Summary | 'Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit of TFIID that is present in all TFIID complexes and interacts with TBP. This subunit also interacts with another small subunit, TAF13, to form a heterodimer with a structure similar to the histone core structure. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]' Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233323 | TAF11 (Myc-DDK tagged) - Homo sapiens TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa (TAF11), transcript variant 2 |
USD 420.00 |
|
RG233323 | TAF11 (GFP-tagged) - Homo sapiens TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa (TAF11), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review