GABRG3 (NM_001270873) Human Untagged Clone
CAT#: SC333005
GABRG3 (untagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), transcript variant 2
"NM_001270873" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GABRG3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270873, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCGAAGCTGCTGCTCCTCCTCTGCCTGTTCTCGGGCTTGCACGCGCGGTCCAGAAAGGTGGAAG AGGATGAATATGAAGATTCATCATCAAACCAAAAGTGGGTCTTGGCTCCAAAATCCCAAGACACCGACGT GACTCTTATTCTCAACAAGTTGCTAAGAGAATATGATAAAAAGCTGAGGCCAGATATTGGAATAAAACCG ACCGTAATTGACGTTGACATTTATGTTAACAGCATTGGTCCTGTGTCATCAATAAACATGGAATACCAAA TTGACATATTTTTTGCTCAGACCTGGACAGATAGTCGCCTTCGATTCAACAGCACAATGAAAATTCTTAC TCTGAACAGCAACATGGTGGGGTTAATCTGGATCCCAGACACCATCTTCCGCAATTCTAAAACCGCAGAG GCTCACTGGATCACCACACCCAATCAGCTCCTCCGGATTTGGAATGACGGGAAAATCCTTTACACTTTGA GGCTCACCATCAATGCTGAGTGCCAGCTGCAGCTGCACAACTTCCCCATGGACGAACACTCCTGCCCGCT GATTTTCTCCAGCTATGGCTATCCCAAAGAAGAAATGATTTATAGATGGAGAAAAAATTCAGTGGAGGCA GCTGACCAGAAATCATGGCGGCTTTATCAGTTTGACTTCATGGGCCTCAGAAACACCACAGAAATCGTGA CAACGTCTGCAGGTAGGAATTTACTGAAAGAGGCACAGCTCTCAAAAGCCAGAGAGGCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270873 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270873.1, NP_001257802.1 |
RefSeq Size | 1512 bp |
RefSeq ORF | 762 bp |
Locus ID | 2567 |
Cytogenetics | 15q12 |
Protein Families | Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (2) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is longer/shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233556 | GABRG3 (Myc-DDK tagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), transcript variant 2 |
USD 420.00 |
|
RG233556 | GABRG3 (GFP-tagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review