BASP1 (NM_001271606) Human Untagged Clone

CAT#: SC333069

BASP1 (untagged) - Homo sapiens brain abundant, membrane attached signal protein 1 (BASP1), transcript variant 2


  "NM_001271606" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BASP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BASP1
Synonyms CAP-23; CAP23; NAP-22; NAP22
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271606, the custom clone sequence may differ by one or more nucleotides


ATGGGAGGCAAGCTCAGCAAGAAGAAGAAGGGCTACAATGTGAACGACGAGAAAGCCAAGGAGAAAGACA
AGAAGGCCGAGGGCGCGGCGACGGAAGAGGAGGGGACCCCGAAGGAGAGTGAGCCCCAGGCGGCCGCAGA
GCCCGCCGAGGCCAAGGAGGGCAAGGAGAAGCCCGACCAGGACGCCGAGGGCAAGGCCGAGGAGAAGGAG
GGCGAGAAGGACGCGGCGGCTGCCAAGGAGGAGGCCCCGAAGGCGGAGCCCGAGAAGACGGAGGGCGCGG
CAGAGGCCAAGGCTGAGCCCCCGAAGGCGCCCGAGCAGGAGCAGGCGGCCCCCGGCCCCGCTGCGGGCGG
CGAGGCCCCCAAAGCTGCTGAGGCCGCCGCGGCCCCGGCCGAGAGCGCGGCCCCTGCCGCCGGGGAGGAG
CCCAGCAAGGAGGAAGGGGAACCCAAAAAGACTGAGGCGCCCGCAGCTCCTGCCGCCCAGGAGACCAAAA
GTGACGGGGCCCCAGCTTCAGACTCAAAACCCGGCAGCTCGGAGGCTGCCCCCTCTTCCAAGGAGACCCC
CGCAGCCACGGAAGCGCCTAGTTCCACACCCAAGGCCCAGGGCCCCGCAGCCTCTGCAGAAGAGCCCAAG
CCGGTGGAGGCCCCGGCAGCTAATTCCGACCAAACCGTAACCGTGAAAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271606
ORF Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271606.1, NP_001258535.1
RefSeq Size 1727
RefSeq ORF 684
Locus ID 10409
Gene Summary This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.