STX10 (NM_001271610) Human Untagged Clone

CAT#: SC333071

STX10 (untagged) - Homo sapiens syntaxin 10 (STX10), transcript variant 3


  "NM_001271610" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "STX10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STX10
Synonyms hsyn10; SYN10
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271610, the custom clone sequence may differ by one or more nucleotides


ATGTCTCTCGAAGACCCCTTTTTTGTAGTCCGAGGCGAGGTGCAGAAGGCGGTGAACACGGCCCGCGGGC
TGTACCAGCGCTGGTGCGAGCTCCTGCAGGAAAGCGCGGCGGTCGGACGCGAGGAGCTGGACTGGACGAC
CAATGAGCTGCGGAATGGCCTGCGCAGCATCGAGTGGGACCTCGAGGACCTGGAAGAGACCATCGGTATA
GTGGAAGCCAACCCAGGCAAGTTCAAGCTCCCAGCCGGGGACCTGCAGGAGAGAAAGGTGTTCGTGGAGC
GGATGCGAGAGGCAGTCCAGGAAATGAAGGACCATATGGTCAGCCCAACAGCCGTAGCATTTTTGGAGAG
GAATAACAGAGAGATACTCGCAGGCAAGCCAGCTGCCCAGAAGTCACCCAGCGACCTGCTGGATGCCAGC
GCAGTCTCGGCCACATCTCGCTACATCGAGGAGCAGCAGGCCACACAGCAGCTGATCATGGATGAACAGG
ATCAACAGCTGGAGATGGTGTCTGGGAGCATCCAGGTTCTGAAGCACATGTCCGGCCGCGTTGGAGAAGA
GCTGGACGAGCAGGGCATCATGCTGGATGCCTTCGCCCAAGAGATGGACCACACCCAGTCCCGCATGGAC
GGGGTCCTCAGGAAGTTGGCCAAAGTATCCCACATGACGAGTGGTGAGTCCCCTCAGGGGAGGGGTCAGT
CCTGGTGGGGGCAGGTTGTAGGTGGTACCCTCTCCCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271610
ORF Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271610.1, NP_001258539.1
RefSeq Size 1410
RefSeq ORF 741
Locus ID 8677
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary This gene belongs to the syntaxin family and encodes a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE). The encoded protein is involved in docking and fusion events at the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.