STX10 (NM_001271611) Human Untagged Clone
CAT#: SC333072
STX10 (untagged) - Homo sapiens syntaxin 10 (STX10), transcript variant 4
"NM_001271611" in other vectors (2)
Product Images
Other products for "STX10"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | STX10 |
Synonyms | hsyn10; SYN10 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271611, the custom clone sequence may differ by one or more nucleotides
ATGTCTCTCGAAGACCCCTTTTTTGTAGTCCGAGGCGAGGTGCAGAAGGCGGTGAACACGGCCCGCGGGC TGTACCAGCGCTGGTGCGAGCTCCTGCAGGAAAGCGCGGCGGTCGGACGCGAGGAGCTGGACTGGACGAC CAATGAGCTGCGGAATGGCCTGCGCAGCATCGAGTGGGACCTCGAGGACCTGGAAGAGACCATCGGTATA GTGGAAGCCAACCCAGGCAAGCCAGCTGCCCAGAAGTCACCCAGCGACCTGCTGGATGCCAGCGCAGTCT CGGCCACATCTCGCTACATCGAGGAGCAGCAGGCCACACAGCAGCTGATCATGGATGAACAGGATCAACA GCTGGAGATGGTGTCTGGGAGCATCCAGGTTCTGAAGCACATGTCCGGCCGCGTTGGAGAAGAGCTGGAC GAGCAGGGCATCATGCTGGATGCCTTCGCCCAAGAGATGGACCACACCCAGTCCCGCATGGACGGGGTCC TCAGGAAGTTGGCCAAAGTATCCCACATGACGAGTGACCGCCGACAGTGGTGTGCCATCGCCGTGCTAGT GGGGGTGCTTCTCCTCGTTCTCATCTTACTATTCTCTCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271611 |
ORF Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271611.1, NP_001258540.1 |
RefSeq Size | 1173 |
RefSeq ORF | 603 |
Locus ID | 8677 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
Gene Summary | This gene belongs to the syntaxin family and encodes a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE). The encoded protein is involved in docking and fusion events at the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012] Transcript Variant: This variant (4) uses two alternate splice sites and lacks an internal exon, resulting in the loss of an in-frame segment in the coding region, compared to variant 1. This results in a shorter isoform (4), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.