Dysbindin (DTNBP1) (NM_001271667) Human Untagged Clone

CAT#: SC333080

DTNBP1 (untagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 3


  "NM_001271667" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DTNBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DTNBP1
Synonyms BLOC1S8; DBND; HPS7; My031; SDY
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271667, the custom clone sequence may differ by one or more nucleotides


ATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTCC
CAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAGGT
AGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAG
TCCCAGCAACTGGAGAATTACAAGAAAAATAAGAGGAAGGAACTTGAAACCTTCAAAGCTGAACTAGATG
CAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGAAGCTGAAGGAGCGGCAGAAGTT
TTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACCTGTCCACTGGCTACCTGCAGATTGCAGAGCGG
CGAGAGCCCATAGGCAGCATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGACCTGATGG
ACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTGCTGTCCCC
CGCCTTAGGGCCTGAATCCAGTACCTGTCAGAATGAGATTACCCTCCAGGTTCCAAATCCCTCAGAATTA
AGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGACTCGGCCACCCGGGACATCAGTGAGGGTGGGG
AGTCCCCCGTTGTTCAGTCCGATGAGGAGGAAGTTCAGGTGGACACTGCCCTGGCCACATCACACACTGA
CAGAGAGGCCACTCCGGATGGTGGTGAGGACAGCGACTCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001271667
ORF Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271667.1, NP_001258596.1
RefSeq Size 1469
RefSeq ORF 813
Locus ID 84062
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) contains an alternate splice site in the 5' coding region and is predicted to use a downstream start codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus than isoform a. This variant and protein are described by Talbot et al. (PMID:21390302).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.