Dysbindin (DTNBP1) (NM_001271667) Human Untagged Clone
CAT#: SC333080
DTNBP1 (untagged) - Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 3
"NM_001271667" in other vectors (2)
Product Images
Other products for "DTNBP1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DTNBP1 |
Synonyms | BLOC1S8; DBND; HPS7; My031; SDY |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271667, the custom clone sequence may differ by one or more nucleotides
ATGCTTTCTGCGCACTGGGAGAAGAAAAAGACAAGCCTCGTGGAGCTGCAAGAGCAGCTCCAGCAGCTCC CAGCTTTAATCGCAGACTTAGAATCCATGACAGCAAATCTGACTCATTTAGAGGCGAGTTTTGAGGAGGT AGAGAACAACCTGCTGCATCTGGAAGACTTATGTGGGCAGTGTGAATTAGAAAGATGCAAACATATGCAG TCCCAGCAACTGGAGAATTACAAGAAAAATAAGAGGAAGGAACTTGAAACCTTCAAAGCTGAACTAGATG CAGAGCACGCCCAGAAGGTCCTGGAAATGGAGCACACCCAGCAAATGAAGCTGAAGGAGCGGCAGAAGTT TTTTGAGGAAGCCTTCCAGCAGGACATGGAGCAGTACCTGTCCACTGGCTACCTGCAGATTGCAGAGCGG CGAGAGCCCATAGGCAGCATGTCATCCATGGAAGTGAACGTGGACATGCTGGAGCAGATGGACCTGATGG ACATATCGGACCAGGAGGCCCTGGACGTCTTCCTGAACTCTGGAGGAGAAGAGAACACTGTGCTGTCCCC CGCCTTAGGGCCTGAATCCAGTACCTGTCAGAATGAGATTACCCTCCAGGTTCCAAATCCCTCAGAATTA AGAGCCAAGCCACCTTCTTCTTCCTCCACCTGCACCGACTCGGCCACCCGGGACATCAGTGAGGGTGGGG AGTCCCCCGTTGTTCAGTCCGATGAGGAGGAAGTTCAGGTGGACACTGCCCTGGCCACATCACACACTGA CAGAGAGGCCACTCCGGATGGTGGTGAGGACAGCGACTCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271667 |
ORF Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271667.1, NP_001258596.1 |
RefSeq Size | 1469 |
RefSeq ORF | 813 |
Locus ID | 84062 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) contains an alternate splice site in the 5' coding region and is predicted to use a downstream start codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus than isoform a. This variant and protein are described by Talbot et al. (PMID:21390302). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.