SERPINB6 (NM_001271822) Human Untagged Clone

CAT#: SC333121

SERPINB6 (untagged) - Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 3


  "NM_001271822" in other vectors (2)

Reconstitution Protocol

USD 390.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "SERPINB6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SERPINB6
Synonyms CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271822, the custom clone sequence may differ by one or more nucleotides


ATGGGGGCGGCGCAGAGCCTCCCGGGCCACAGGTCTGCCATCATGGATGTTCTCGCAGAAGCAAATGGCA
CCTTTGCCTTAAACCTTTTGAAAACGCTGGGTAAAGACAACTCGAAGAATGTGTTTTTCTCACCCATGAG
CATGTCCTGTGCCCTGGCCATGGTCTACATGGGGGCAAAGGGAAACACCGCTGCACAGATGGCCCAGATA
CTTTCTTTCAATAAAAGTGGCGGTGGTGGAGACATCCACCAGGGCTTCCAGTCTCTTCTCACCGAAGTGA
ACAAGACTGGCACGCAGTACTTGCTTAGGATGGCCAACAGGCTCTTTGGGGAAAAGTCTTGTGATTTCCT
CTCATCTTTTAGAGATTCCTGCCAAAAATTCTACCAAGCAGAGATGGAGGAGCTTGACTTTATCAGCGCC
GTAGAGAAGTCCAGAAAACACATAAACACCTGGGTAGCTGAAAAGACAGAAGGTAAAATTGCGGAGTTGC
TCTCTCCGGGCTCAGTGGATCCATTGACAAGGCTGGTTCTGGTGAATGCTGTCTATTTCAGAGGAAACTG
GGATGAACAGTTTGACAAGGAGAACACCGAGGAGAGACTGTTTAAAGTCAGCAAGAATGAGGAGAAACCT
GTGCAAATGATGTTTAAGCAATCTACTTTTAAGAAGACCTATATAGGAGAAATATTTACCCAAATCTTGG
TGCTTCCATATGTTGGCAAGGAACTGAATATGATCATCATGCTTCCGGACGAGACCACTGACTTGAGAAC
GGTGGAGAAAGAACTCACTTACGAGAAGTTCGTAGAATGGACGAGGCTGGACATGATGGATGAAGAGGAG
GTGGAAGTGTCCCTCCCGCGGTTTAAACTAGAGGAAAGCTACGACATGGAGAGTGTCCTGCGCAACCTGG
GCATGACTGATGCCTTCGAGCTGGGCAAGGCAGACTTCTCTGGAATGTCCCAGACAGACCTGTCTCTGTC
CAAGGTCGTGCACAAGTCTTTTGTGGAGGTCAATGAGGAAGGCACGGAGGCTGCAGCCGCCACAGCTGCC
ATCATGATGATGCGGTGTGCCAGATTCGTCCCCCGCTTCTGCGCCGACCACCCCTTCCTTTTCTTCATCC
AGCACAGCAAGACCAACGGGATTCTCTTCTGCGGCCGCTTTTCCTCTCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271822
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271822.1, NP_001258751.1
RefSeq Size 1492 bp
RefSeq ORF 1173 bp
Locus ID 5269
Cytogenetics 6p25.2
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]'
Transcript Variant: This variant (3) contains an alternate 5' exon, which includes an upstream in-frame AUG start codon, compared to variant 1. The resulting isoform (c) has a longer N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.