SERPINB6 (NM_001271823) Human Untagged Clone

CAT#: SC333122

SERPINB6 (untagged) - Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SERPINB6
• Synonyms: CAP; DFNB91; MSTP057; PI-6; PI6; PTI; SPI3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271823, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTTCAAGGCAAAGAGGAAACTTTAACTACAAATTGGCATTTAAGTCTGCCATCATGGATGTTCTCG
  CAGAAGCAAATGGCACCTTTGCCTTAAACCTTTTGAAAACGCTGGGTAAAGACAACTCGAAGAATGTGTT
  TTTCTCACCCATGAGCATGTCCTGTGCCCTGGCCATGGTCTACATGGGGGCAAAGGGAAACACCGCTGCA
  CAGATGGCCCAGATACTTTCTTTCAATAAAAGTGGCGGTGGTGGAGACATCCACCAGGGCTTCCAGTCTC
  TTCTCACCGAAGTGAACAAGACTGGCACGCAGTACTTGCTTAGGATGGCCAACAGGCTCTTTGGGGAAAA
  GTCTTGTGATTTCCTCTCATCTTTTAGAGATTCCTGCCAAAAATTCTACCAAGCAGAGATGGAGGAGCTT
  GACTTTATCAGCGCCGTAGAGAAGTCCAGAAAACACATAAACACCTGGGTAGCTGAAAAGACAGAAGGTA
  AAATTGCGGAGTTGCTCTCTCCGGGCTCAGTGGATCCATTGACAAGGCTGGTTCTGGTGAATGCTGTCTA
  TTTCAGAGGAAACTGGGATGAACAGTTTGACAAGGAGAACACCGAGGAGAGACTGTTTAAAGTCAGCAAG
  AATGAGGAGAAACCTGTGCAAATGATGTTTAAGCAATCTACTTTTAAGAAGACCTATATAGGAGAAATAT
  TTACCCAAATCTTGGTGCTTCCATATGTTGGCAAGGAACTGAATATGATCATCATGCTTCCGGACGAGAC
  CACTGACTTGAGAACGGTGGAGAAAGAACTCACTTACGAGAAGTTCGTAGAATGGACGAGGCTGGACATG
  ATGGATGAAGAGGAGGTGGAAGTGTCCCTCCCGCGGTTTAAACTAGAGGAAAGCTACGACATGGAGAGTG
  TCCTGCGCAACCTGGGCATGACTGATGCCTTCGAGCTGGGCAAGGCAGACTTCTCTGGAATGTCCCAGAC
  AGACCTGTCTCTGTCCAAGGTCGTGCACAAGTCTTTTGTGGAGGTCAATGAGGAAGGCACGGAGGCTGCA
  GCCGCCACAGCTGCCATCATGATGATGCGGTGTGCCAGATTCGTCCCCCGCTTCTGCGCCGACCACCCCT
  TCCTTTTCTTCATCCAGCACAGCAAGACCAACGGGATTCTCTTCTGCGGCCGCTTTTCCTCTCCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271823
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271823.1, NP_001258752.1
• RefSeq Size: 1588 bp
• RefSeq ORF: 1188 bp
• Locus ID: 5269
• Cytogenetics: 6p25.2
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]'
  Transcript Variant: This variant (4) contains an alternate 5' exon, which includes an upstream in-frame AUG start codon, compared to variant 1. The resulting isoform (d) has a longer N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.