RCN2 (NM_001271837) Human Untagged Clone

CAT#: SC333131

RCN2 (untagged) - Homo sapiens reticulocalbin 2, EF-hand calcium binding domain (RCN2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCN2
• Synonyms: E6BP; ERC-55; ERC55; TCBP49
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271837, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGCTGGGCCCGAGGACCGCGGCGTTGGGGCTGCTGCTGCTGTGCGCCGCCGCGGCCGGCGCCGGCA
  AGGCCGAGGAGCTGCACTACCCGCTGGGCGAGCGCCGCAGCGACTACGACCGCGAGGCGCTGCTGGGCGT
  CCAGGAAGATGTGGATGAATATGTTAAACTCGGCCACGAAGAGCAGCAAAAAAGACTGCAGGCGATCATA
  AAGAAAATCGACTTGGACTCAGATGGCTTTCTCACTGAAAGTGAACTCAGTTCATGGATTCAGATGTCTT
  TTAAGCATTATGCTATGCAAGAAGCAAAACAACAGTTTGTTGAATATGATAAAAACAGTGATGATACTGT
  GACTTGGGATGAATATAACATTCAGATGTATGATCGTGTGATTGACTTTGATGAGAACACTGCTCTGGAT
  GATGCAGAAGAGGAGTCCTTTAGGAAGGAATTTGCCATTTGTAAAAAACAGTCTTTCTGTTTTTGGCTTC
  TTCGATTTAATCTTCACTTAAAGGACAAGAAGCGATTTGAAAAAGCTAACCAGGATTCAGGTCCCGGTTT
  GAGTCTTGAAGAATTTATTGCTTTTGAGCATCCTGAAGAAGTTGATTATATGACGGAATTTGTCATTCAA
  GAAGCTTTAGAAGAACATGACAAAAATGGTGATGGATTTGTTAGTTTGGAAGAATTTCTTGGTGATTACA
  GGTGGGATCCAACTGCAAATGAAGATCCAGAATGGATACTTGTTGAGAAAGACAGATTCGTGAATGATTA
  TGACAAAGATAACGATGGCAGGCTTGATCCCCAAGAGCTGTTACCTTGGGTAGTACCTAATAATCAGGGC
  ATTGCACAAGAGGAGGCGCTTCATCTAATTGATGAAATGGATTTGAATGGTGACAAAAAGCTCTCTGAAG
  AAGAGATTCTGGAAAACCCGGACTTGTTTCTCACCAGTGAAGCCACAGATTATGGCAGACAGCTCCATGA
  TGACTATTTCTATCATGATGAGCTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271837
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271837.1, NP_001258766.1
• RefSeq Size: 2267 bp
• RefSeq ORF: 1008 bp
• Locus ID: 5955
• Cytogenetics: 15q24.3
• Gene Summary: 'The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]'
  Transcript Variant: This variant (2) has an additional in-frame exon in the coding region, compared to variant 1. The resulting isoform (b) is longer than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.