SHISA5 (NM_001272068) Human Untagged Clone
CAT#: SC333202
SHISA5 (untagged) - Homo sapiens shisa family member 5 (SHISA5), transcript variant 5
"NM_001272068" in other vectors (2)
Product Images
Other products for "SHISA5"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SHISA5 |
Synonyms | SCOTIN |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001272068, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCCCGTGGACTCAGCCTCTTCCCCGAGTCCTGTCCAGATTTCTGCTGTGGTACCTGTGATGACC AATACTGCTGCTCTGACGTGCTGAAGAAATTTGTGTGGAGCGAGGAAAGGTGTGCTGTGCCTGAGGCCAG CGTGCCTGCCAGTGTAGAGCCGGTGGAGCAGCTGGGCTCGGCGCTGAGGTTTCGCCCTGGCTACAACGAC CCCATGTCAGGGTTCGGAGCGACCTTGGCCGTTGGCCTGACCATCTTTGTGCTGTCTGTCGTCACTATCA TCATCTGCTTCACCTGCTCCTGCTGCTGCCTTTACAAGACGTGCCGCCGACCACGTCCGGTTGTCACCAC CACCACATCCACCACTGTGGTGCATGCCCCTTATCCTCAGCCTCCAAGTGTGCCGCCCAGCTACCCTGGA CCAAGCTACCAGGGCTACCACACCATGCCGCCTCAGCCAGGGATGCCAGCAGCACCCTACCCAATGCAGT ACCCACCACCTTACCCAGCCCAGCCCATGGGCCCACCGGCCTACCACGAGACCCTGGCTGGAGGAGCAGC CGCGCCCTACCCCGCCAGCCAGCCTCCTTACAACCCGGCCTACATGGATGCCCCGAAGGCGGCCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272068 |
ORF Size | 630 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001272068.1, NP_001258997.1 |
RefSeq Size | 2385 |
RefSeq ORF | 630 |
Locus ID | 51246 |
Protein Families | Transmembrane |
Protein Pathways | p53 signaling pathway |
Gene Summary | This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (5) uses two alternate exons in the 5' UTR and initiates translation at a downstream AUG, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Variants 3, 4 and 5 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.