SHISA5 (NM_001272083) Human Untagged Clone

CAT#: SC333206

SHISA5 (untagged) - Homo sapiens shisa family member 5 (SHISA5), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SHISA5
• Synonyms: SCOTIN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272083, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGTTCGGAGCGACCTTGGCCGTTGGCCTGACCATCTTTGTGCTGTCTGTCGTCACTATCATCATCT
  GCTTCACCTGCTCCTGCTGCTGCCTTTACAAGACGTGCCGCCGACCACGTCCGGTTGTCACCACCACCAC
  ATCCACCACTGTGGTGCATGCCCCTTATCCTCAGCCTCCAAGTGTGCCGCCCAGCTACCCTGGACCAAGC
  TACCAGGGCTACCACACCATGCCGCCTCAGCCAGGGATGCCAGCAGCACCCTACCCAATGCAGTACCCAC
  CACCTTACCCAGCCCAGCCCATGGGCCCACCGGCCTACCACGAGACCCTGGCTGGTGAGTGCCCCTGCCA
  ACTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272083
• ORF Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001272083.1, NP_001259012.1
• RefSeq Size: 2216
• RefSeq ORF: 357
• Locus ID: 51246
• Protein Families: Transmembrane
• Protein Pathways: p53 signaling pathway
• Gene Summary: This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
  Transcript Variant: This variant (7) contains an alternate 5' terminal exon, initiates translation at an alternate start codon, and differs at the 3' end compared to variant 1. The encoded isoform (e) has distinct N- and C- termini and is shorter than isoform a.