C18orf1 (LDLRAD4) (NM_001276251) Human Untagged Clone
CAT#: SC333223
LDLRAD4 (untagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant e1
"NM_001276251" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LDLRAD4 |
Synonyms | C18orf1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001276251, the custom clone sequence may differ by one or more nucleotides
ATGCGGTTGGACAGTCATCTTGAATGTATTTCAAGCACACAGGAAGGGTGCCTGTGGCCTTCAGACAGCG CCGCACCGCGGCTGGGCGCCTCGGAGATCATGCATGCCCCGCGGTCCAGGGACAGGTTCACAGCGCCGTC CTTCATCCAGAGGGATCGCTTCAGCCGCTTCCAGCCCACCTACCCCTATGTGCAGCACGAGATTGATCTT CCTCCCACCATCTCCCTGTCCGACGGTGAAGAGCCACCTCCTTACCAGGGGCCCTGCACCCTGCAGCTCC GGGACCCTGAACAGCAGATGGAACTCAACCGAGAGTCCGTGAGGGCCCCACCCAACCGAACCATATTTGA CAGTGATTTAATAGACATTGCTATGTATAGCGGGGGTCCATGCCCACCCAGCAGCAACTCGGGCATCAGT GCAAGCACCTGCAGCAGTAACGGGAGGATGGAGGGGCCACCCCCCACATACAGCGAGGTGATGGGCCACC ACCCAGGCGCCTCTTTCCTCCATCACCAGCGCAGCAACGCACACAGGGGCAGCAGACTGCAGTTTCAGCA GAACAATGCAGAGAGCACAATAGTACCCATCAAAGGCAAAGATAGGAAGCCTGGGAACCTGGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276251 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276251.1, NP_001263180.1 |
RefSeq Size | 8682 bp |
RefSeq ORF | 627 bp |
Locus ID | 753 |
Cytogenetics | 18p11.21 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | '' Transcript Variant: This variant (e1) contains an alternate 5' terminal exon, differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant a1. The encoded isoform (epsilon 1) is shorter and has a distinct N-terminus, compared to isoform alpha 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233441 | LDLRAD4 (Myc-DDK tagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant e1 |
USD 420.00 |
|
RG233441 | LDLRAD4 (GFP-tagged) - Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant e1 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review