Apoptosis repressor with CARD (NOL3) (NM_001276307) Human Untagged Clone

CAT#: SC333236

NOL3 (untagged) - Homo sapiens nucleolar protein 3 (apoptosis repressor with CARD domain) (NOL3), transcript variant 4


  "NM_001276307" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NOL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NOL3
Synonyms ARC; FCM; MYOCL1; MYP; NOP; NOP30
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276307, the custom clone sequence may differ by one or more nucleotides


ATGGGCAACGCGCAGGAGCGGCCGTCAGAGACTATCGACCGCGAGCGGAAACGCCTGGTCGAGACGCTGC
AGGCGGACTCGGGACTGCTGTTGGACGCGCTGCTGGCGCGGGGCGTGCTCACCGGGCCAGAGTACGAGGC
ATTGGATGCACTGCCTGATGCCGAGCGCAGGGTGCGCCGCCTACTGCTGCTGGTGCAGGGCAAGGGCGAG
GCCGCCTGCCAGGAGCTGCTACGCTGTGCCCAGCGTACCGCGGGCGCGCCGGACCCCGCTTGGGACTGGC
AGCACGTGGGTCCGGGCTACCGGGACCGCAGCTATGACCCTCCATGCCCAGGCCACTGGACGCCGGAGGC
ACCCGGCTCGGGGACCACATGCCCCGGGTTGCCCAGAGCTTCAGACCCTGACGAGGCCGGGGGCCCTGAG
GGCTCCGAGGCGGTGCAATCCGGGACCCCGGAGGAGCCAGAGCCAGAGCTGGAAGCTGAGGCCTCTAAAG
AGGCTGAACCGGAGCCGGAGCCAGAGCCAGAGCTGGAACCCGAGGCTGAAGCAGAACCAGAGCCGGAACT
GGAGCCAGAACCGGACCCAGAGCCCGAGCCCGACTTCGAGGAAAGGGACGAGTCCGAAGATTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001276307
ORF Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001276307.1, NP_001263236.1
RefSeq Size 1564
RefSeq ORF 627
Locus ID 8996
Gene Summary This gene encodes an anti-apoptotic protein that has been shown to down-regulate the enzyme activities of caspase 2, caspase 8 and tumor protein p53. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 4, and 5 encode the same protein (isoform MYP).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.