Apoptosis repressor with CARD (NOL3) (NM_001276307) Human Untagged Clone
CAT#: SC333236
NOL3 (untagged) - Homo sapiens nucleolar protein 3 (apoptosis repressor with CARD domain) (NOL3), transcript variant 4
"NM_001276307" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NOL3 |
Synonyms | ARC; FCM; MYOCL1; MYP; NOP; NOP30 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001276307, the custom clone sequence may differ by one or more nucleotides
ATGGGCAACGCGCAGGAGCGGCCGTCAGAGACTATCGACCGCGAGCGGAAACGCCTGGTCGAGACGCTGC AGGCGGACTCGGGACTGCTGTTGGACGCGCTGCTGGCGCGGGGCGTGCTCACCGGGCCAGAGTACGAGGC ATTGGATGCACTGCCTGATGCCGAGCGCAGGGTGCGCCGCCTACTGCTGCTGGTGCAGGGCAAGGGCGAG GCCGCCTGCCAGGAGCTGCTACGCTGTGCCCAGCGTACCGCGGGCGCGCCGGACCCCGCTTGGGACTGGC AGCACGTGGGTCCGGGCTACCGGGACCGCAGCTATGACCCTCCATGCCCAGGCCACTGGACGCCGGAGGC ACCCGGCTCGGGGACCACATGCCCCGGGTTGCCCAGAGCTTCAGACCCTGACGAGGCCGGGGGCCCTGAG GGCTCCGAGGCGGTGCAATCCGGGACCCCGGAGGAGCCAGAGCCAGAGCTGGAAGCTGAGGCCTCTAAAG AGGCTGAACCGGAGCCGGAGCCAGAGCCAGAGCTGGAACCCGAGGCTGAAGCAGAACCAGAGCCGGAACT GGAGCCAGAACCGGACCCAGAGCCCGAGCCCGACTTCGAGGAAAGGGACGAGTCCGAAGATTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276307 |
ORF Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001276307.1, NP_001263236.1 |
RefSeq Size | 1564 |
RefSeq ORF | 627 |
Locus ID | 8996 |
Gene Summary | This gene encodes an anti-apoptotic protein that has been shown to down-regulate the enzyme activities of caspase 2, caspase 8 and tumor protein p53. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 4, and 5 encode the same protein (isoform MYP). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233442 | NOL3 (Myc-DDK tagged) - Homo sapiens nucleolar protein 3 (apoptosis repressor with CARD domain) (NOL3), transcript variant 4 |
USD 420.00 |
|
RG233442 | NOL3 (GFP-tagged) - Homo sapiens nucleolar protein 3 (apoptosis repressor with CARD domain) (NOL3), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review