B4GALNT1 (NM_001276469) Human Untagged Clone

CAT#: SC333256

B4GALNT1 (untagged) - Homo sapiens beta-1,4-N-acetyl-galactosaminyl transferase 1 (B4GALNT1), transcript variant 3


  "NM_001276469" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "B4GALNT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B4GALNT1
Synonyms GALGT; GalNAc-T; GALNACT; SPG26
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276469, the custom clone sequence may differ by one or more nucleotides


ATGTGGCTGGGCCGCCGGGCCCTGTGCGCTCTGGTCCTTCTGCTCGCCTGCGCCTCGCTGGGGCTCCTGT
ACGCGAGCACCCGGGACGCGCCCGGCCTCCGGCTACCTCTTGCGCCGTGGGCGCCCCCGCAAAGCCCCCG
CAGGCCCGAGCTGCCAGATCTTGCTCCTGAGCCCCGCTACGCACACATCCCGGTCAGGATCAAGGAGCAA
GTAGTGGGGCTGCTGGCTTGGAACAACTGCAGTTGTGAGTCCAGTGGGGGGGGCCTCCCCCTCCCCTTCC
AGAAACAAGTCCGAGCTATTGACCTCACCAAGGCCTTTGACCCTGCAGAGCTGAGGGCTGCCTCTGCCAC
AAGAGAGCAGGAGTTCCAGGCCTTTCTGTCGAGGAGCCAGTCCCCAGCTGACCAGCTGCTCATAGCCCCT
GCCAACTCCCCGCTCCAGTACCCCCTACAGGGTGTGGAAGTTCAGCCCCTCAGGAGCATCTTGGTGCCAG
GGCTGAGCCTTCAGGCAGCTTCTGGTCAGGAGGTATACCAGGTGAACCTGACTGCCTCCCTAGGCACCTG
GGACGTGGCAGGGGAAGTGACTGGAGTTACTCTCACTGGAGAGGGTCAGGCAGATCTCACCCTTGTCAGC
CCAGGGCTGGACCAACTCAACAGGCAACTACAACTGGTCACTTACAGCAGCCGAAGCTACCAGACCAACA
CAGCAGACACAGGTGCAAGGCCTGGGTGGAGAGACGGGCAGGCTGGGCAAACAGAGAAGAACCAGAAAGG
CTGGAGTGGGCAAATGGCAGAGGGCATGGGAGGCATCTGGGCTATGGCCAGAGCTGTCCAGCCACACAAT
GGGTGCTTCAACTGGACCAGCAGGGCCAGAGGGAGAAAGGGGGCCTTTGTTCATCTGGGGCTGGAGCAGG
CCAGAGGGAAACCCGAGCCTTGGGTGTGTCTCCCCTTTAGGCCAACTGTGGGGGGCCCCAGGAAGAGACT
TGTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001276469
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276469.1, NP_001263398.1
RefSeq Size 2013 bp
RefSeq ORF 987 bp
Locus ID 2583
Cytogenetics 12q13.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - ganglio series, Metabolic pathways
Gene Summary 'GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]'
Transcript Variant: This variant (3) lacks several 3' exons and has a 3' end that extends into an intron compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.