XPNPEP3 (NM_001204827) Human Untagged Clone

CAT#: SC333314

XPNPEP3 (untagged) - Human X-prolyl aminopeptidase (aminopeptidase P) 3, putative (XPNPEP3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XPNPEP3
• Synonyms: APP3; ICP55; NPHPL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204827, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTTGGCTGCTCTCAGCCCCCAAGCTGGTTCCCGCTGTAGCAAACGTCCGCGGCCTCTCAGGGTCTT
  ACTTTGTCACCCAAGCTGGAGTGCAGTGGCGTGATCCCATTACACTGCAACCTATGTCTTCCAGGCTCAA
  GCAGTCTTTCTACCAGCTTCCCGAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204827
• ORF Size: 168 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204827.1, NP_001191756.1
• RefSeq Size: 1462
• RefSeq ORF: 168
• Locus ID: 63929
• Protein Families: Druggable Genome, Protease
• Gene Summary: The protein encoded by this gene belongs to the family of X-pro-aminopeptidases that utilize a metal cofactor, and remove the N-terminal amino acid from peptides with a proline residue in the penultimate position. This protein has been shown to localize to the mitochondria of renal cells, and have a role in ciliary function. Mutations in this gene are associated with nephronophthisis-like nephropathy-1. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene, however, expression of some of these isoforms in vivo is not known. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (2) shares the first exon in common with variant 1 and contains two alternate exons at the 3' end. This results in a frame-shift and a very short isoform (2) with a distinct C-terminus compared to isoform 1. This variant is supported by transcript evidence, but the encoded isoform lacks experimental support.