COMMD6 (NM_001287393) Human Untagged Clone

CAT#: SC333316

COMMD6 (untagged) - Human COMM domain containing 6 (COMMD6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COMMD6
• Synonyms: Acrg
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001287393, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGTGAGCTCAGACACTTGCAGATCTCTTAAGTATCCTTACGTTGCAGTGATGCTAAAAGTGGCAG
  ATCATTCAGGCCAAGTAAAGACCAAGTGCTTTGAAATGACGATTCCACAGTTTCAGAATTTCTACAGACA
  GTTCAAGGAAATTGCTGCAGTTATTGAAACGGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287393
• ORF Size: 177 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001287393.1, NP_001274322.1
• RefSeq Size: 1860
• RefSeq ORF: 177
• Locus ID: 170622
• Gene Summary: COMMD6 belongs to a family of NF-kappa-B (see RELA; MIM 164014)-inhibiting proteins characterized by the presence of a COMM domain (see COMMD1; MIM 607238) (de Bie et al., 2006 [PubMed 16573520]). [supplied by OMIM, Mar 2009]
  Transcript Variant: This variant (4) is alternatively spliced in the 5' region (which results in translation initiation from an in-frame downstream start codon) and lacks an in-frame coding exon in the 3' region compared to variant 1. The resulting isoform (c) has a shorter N-terminus and lacks a 13 aa protein segment compared to isoform 1. Variants 3-5 encode the same isoform.