GLT28D1 (ALG13) (NM_001257235) Human Untagged Clone

CAT#: SC333318

ALG13 (untagged) - Human ALG13, UDP-N-acetylglucosaminyltransferase subunit (ALG13), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALG13
• Synonyms: CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001257235, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGGTCATCTCTTCTATTGTACCTGCA
  GCACGCTTCCTGGGCTGTTACAGTCAATGGACTTATCAACACTGAAATGTTATCCTCCTGGCCAGCCAGA
  AAAATTTTCTGCATTTTTGGATAAAGTTGTTGGATTACAAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001257235
• ORF Size: 186 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001257235.2, NP_001244164.1
• RefSeq Size: 1367
• RefSeq ORF: 186
• Locus ID: 79868
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• Gene Summary: The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (9) has multiple differences, compared to variant 1, including the use of a downstream, in-frame start codon and alternate 3' UTR. Variants 9, 11 and 12 encode the same isoform (7) which is significantly shorter and has a unique C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.