GLIPR2 (NM_001287012) Human Untagged Clone
CAT#: SC333326
GLIPR2 (untagged) - Human GLI pathogenesis-related 2 (GLIPR2), transcript variant 4
"NM_001287012" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GLIPR2 |
Synonyms | C9orf19; GAPR-1; GAPR1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287012, the custom clone sequence may differ by one or more nucleotides
ATGGGCAAGTCAGCTTCCAAACAGTTTCATAATGAGGTCCTGAAGGCCCACAATGAGTACCGGCAGAAGC ACGGCGTCCCCCCACTGAAGCTCTGCAAGAACCTCAACCGGGAGGCTCAACAGACACTTCACGGCCATGG TATGGAAGAACACCAAGAAGATGGGCGTGGGGAAGGCGTCCGCAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287012 |
ORF Size | 189 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001287012.1, NP_001273941.1 |
RefSeq Size | 1933 |
RefSeq ORF | 189 |
Locus ID | 152007 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235432 | GLIPR2 (myc-DDK-tagged) - Human GLI pathogenesis-related 2 (GLIPR2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review