Chloride Channel 5 (CLCN5) (NM_001272102) Human Untagged Clone
CAT#: SC333335
CLCN5 (untagged) - Human chloride channel, voltage-sensitive 5 (CLCN5), transcript variant 5
"NM_001272102" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLCN5 |
Synonyms | ClC-5; CLC5; CLCK2; DENTS; hCIC-K2; NPHL1; NPHL2; XLRH; XRN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001272102, the custom clone sequence may differ by one or more nucleotides
ATGGCCATGTGGCAGGGTGCCATGGATAACAGAGGCTTTCAGCAGGGGAGTTTTAGTAGCTTCCAGAACA GCTCCAGTGATGAAGACCTGATGGACATTCCAGCAACCGCTATGGATTTCTCCATGAGAGATGATGTTCC TCCCTTAGACCGAGAAGTAGGAGGTATCATTATTGGTGATGATAATTTATCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272102 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001272102.1, NP_001259031.1 |
RefSeq Size | 640 bp |
RefSeq ORF | 195 bp |
Locus ID | 1184 |
Cytogenetics | Xp11.23 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Gene Summary | 'This gene encodes a member of the ClC family of chloride ion channels and ion transporters. The encoded protein is primarily localized to endosomal membranes and may function to facilitate albumin uptake by the renal proximal tubule. Mutations in this gene have been found in Dent disease and renal tubular disorders complicated by nephrolithiasis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]' Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR, it lacks several 3' exons but has an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235441 | CLCN5 (myc-DDK-tagged) - Human chloride channel, voltage-sensitive 5 (CLCN5), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review