Chloride Channel 5 (CLCN5) (NM_001272102) Human Untagged Clone

CAT#: SC333335

CLCN5 (untagged) - Human chloride channel, voltage-sensitive 5 (CLCN5), transcript variant 5


  "NM_001272102" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLCN5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLCN5
Synonyms ClC-5; CLC5; CLCK2; DENTS; hCIC-K2; NPHL1; NPHL2; XLRH; XRN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001272102, the custom clone sequence may differ by one or more nucleotides


ATGGCCATGTGGCAGGGTGCCATGGATAACAGAGGCTTTCAGCAGGGGAGTTTTAGTAGCTTCCAGAACA
GCTCCAGTGATGAAGACCTGATGGACATTCCAGCAACCGCTATGGATTTCTCCATGAGAGATGATGTTCC
TCCCTTAGACCGAGAAGTAGGAGGTATCATTATTGGTGATGATAATTTATCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001272102
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272102.1, NP_001259031.1
RefSeq Size 640 bp
RefSeq ORF 195 bp
Locus ID 1184
Cytogenetics Xp11.23
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'This gene encodes a member of the ClC family of chloride ion channels and ion transporters. The encoded protein is primarily localized to endosomal membranes and may function to facilitate albumin uptake by the renal proximal tubule. Mutations in this gene have been found in Dent disease and renal tubular disorders complicated by nephrolithiasis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]'
Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR, it lacks several 3' exons but has an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.