IQSEC2 (NM_001243197) Human Untagged Clone
CAT#: SC333358
IQSEC2 (untagged) - Human IQ motif and Sec7 domain 2 (IQSEC2), transcript variant 3
"NM_001243197" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IQSEC2 |
Synonyms | BRAG1; IQ-ArfGEF; MRX1; MRX18; MRX78 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001243197, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCCCCCGGGAGGAGCAGCAGGTCCACAGCGTCTCATACTCTACACCAGTATTGCTGTCCTACTC AGGTCCTTGACTCCATGAAGCTTACCCCCTCAGGCAGGCTGGCAGAGAGCAGGGAAGAGGAGGAGGAGGA GGAGACTGAGGAAGAGGAAGAGGAAGACGCTCACCAGTTCTGCTGTCCGGCCTCCGAGTGCAGTAGTCCC TCCTCTCGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243197 |
ORF Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243197.1, NP_001230126.1 |
RefSeq Size | 971 |
RefSeq ORF | 222 |
Locus ID | 23096 |
Protein Pathways | Endocytosis |
Gene Summary | This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked cognitive disability. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) shares no exons with variant 1, and differs in the 3' UTR and coding region compared to variant 2. The encoded isoform (3) is significantly shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235464 | IQSEC2 (myc-DDK-tagged) - Human IQ motif and Sec7 domain 2 (IQSEC2), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review