SNRPD1 (NM_001291916) Human Untagged Clone

CAT#: SC333386

SNRPD1 (untagged) - Human small nuclear ribonucleoprotein D1 polypeptide 16kDa (SNRPD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNRPD1
• Synonyms: HsT2456; Sm-D1; SMD1; SNRPD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291916, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCTCGTGAGATTTTTGATGAAATTGAGTCATGAAACTGTAACCATTGAATTGAAGAACGGAACAC
  AGGTCCATGGAACAATCACAGACAGTTTACCTCTGGATACACTACTTGTGGATGTTGAACCTAAGGTGAA
  ATCTAAGAAAAGGGAAGCTGTTGCAGGAAGAGGCAGAGGAAGAGGAAGAGGAAGAGGACGTGGCCGTGGC
  AGAGGAAGAGGGGGTCCTAGGCGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291916
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291916.1, NP_001278845.1
• RefSeq Size: 1514 bp
• RefSeq ORF: 237 bp
• Locus ID: 6632
• Cytogenetics: 18q11.2
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Protein Pathways: Spliceosome, Systemic lupus erythematosus
• Gene Summary: 'This gene encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. The protein may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.