MIER1 (NM_001278215) Human Untagged Clone
CAT#: SC333404
MIER1 (untagged) - Human mesoderm induction early response 1, transcriptional regulator (MIER1), transcript variant 11
"NM_001278215" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MIER1 |
Synonyms | ER1; MI-ER1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278215, the custom clone sequence may differ by one or more nucleotides
ATGTTTATGTTTAATTGGTTTACAGACTGTCTGTGGACTCTTTTCCTGTCAAATTACCAGCCATCTGTTG AATCTTCAAGTCCAGGAGGTTCAGCAACATCAGATGACCATGAATTTGATCCATCAGCTGACATGCTGGT TCATGATTTTGATGATGAACGAACATTAGAAGAGGAAGAAATGATGGAAGGAGAAACAAACTTCAGCTCT GAAATAGAAGATCTTGCAAGGGTAAATAACATGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278215 |
ORF Size | 246 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001278215.1, NP_001265144.1 |
RefSeq Size | 2492 |
RefSeq ORF | 246 |
Locus ID | 57708 |
Gene Summary | This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013] Transcript Variant: This variant (11) lacks multiple 3' exons and its transcription extends past a splice site used in variant 1, resulting in a distinct 3' coding region and 3' UTR. The encoded isoform (j) has a shorter and distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235510 | MIER1 (myc-DDK-tagged) - Human mesoderm induction early response 1, transcriptional regulator (MIER1), transcript variant 11 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review