DYNLT1 (NM_001291603) Human Untagged Clone
CAT#: SC333406
DYNLT1 (untagged) - Human dynein, light chain, Tctex-type 1 (DYNLT1), transcript variant 3
"NM_001291603" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DYNLT1 |
Synonyms | CW-1; TCTEL1; tctex-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291603, the custom clone sequence may differ by one or more nucleotides
ATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATTGTAAAAGAGG CTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAACCAGTGGACCACAAATGTAGT AGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCATTTAAATACATCGAAGAATGGAGCTGGATT ACACACAGCAAGTTCCTGCTTCTGGGACAGCTCTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291603 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291603.1, NP_001278532.1 |
RefSeq Size | 768 bp |
RefSeq ORF | 249 bp |
Locus ID | 6993 |
Cytogenetics | 6q25.3 |
Gene Summary | 'This gene encodes a component of the motor complex, cytoplasmic dynein, which transports cellular cargo along microtubules in the cell. The encoded protein regulates the length of primary cilia which are sensory organelles found on the surface of cells. The protein encoded by this gene interacts with viral proteins, like the minor capsid protein L2 of human papillomavirus, and is required for dynein-mediated delivery of the viral nucleic acid to the host nucleus. This protein interacts with oncogenic nucleoporins to disrupt gene regulation and cause leukemic transformation. Pseudogenes of this gene are present on chromosomes 4 and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]' Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region which results in a frameshift compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235512 | DYNLT1 (myc-DDK-tagged) - Human dynein, light chain, Tctex-type 1 (DYNLT1), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review