Apc11 (ANAPC11) (NM_001289414) Human Untagged Clone
CAT#: SC333413
ANAPC11 (untagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 8
"NM_001289414" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANAPC11 |
Synonyms | APC11; Apc11p; HSPC214 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001289414, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTGAAGATTAAGTGCTGGAACGGCGTGGCCACTTGGCTCTGGGTGGCCAACGATGAGAACTGTG GCATCTGCAGGATGGCATTTAACGGATGCTGCCCTGACTGCAAGGTGCCCGGCGACGACTGCCCGCTGGT GTGGGGCCAGTGCTCCCACTGCTTCCACATGCATTGCATCCTCAAGTGGCTGCACGCACAGCAGGTGCAG CAGCACTGCCCCATGTGCCGCCAGGAATGGAAGTTCAAGGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289414 |
ORF Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001289414.1, NP_001276343.1 |
RefSeq Size | 859 |
RefSeq ORF | 255 |
Locus ID | 51529 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
Gene Summary | Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (8) lacks an exon and contains two alternate exons in the 5' UTR and lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Variants 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 encode the isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235519 | ANAPC11 (myc-DDK-tagged) - Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 8 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review