KRTAP19 (NM_001303120) Human Untagged Clone

CAT#: SC333418

KRTAP19-6 (untagged) - Human keratin associated protein 19-6 (KRTAP19-6), transcript variant KRTAP19-6-V2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRTAP19
• Synonyms: KAP19.6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001303120, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGATACTATGGCAGCTACTACAGAGGCCTGGGATATGGCTGTGGAGGCTTTGGTGGTCTGGGCTATG
  GCTGTGGCTGTGGAGGCTACAGATATGGCTCTGGCTATGGAGGCTATAGATATGGCTGCTGCCGCCCATC
  ATGCCGTGAAGGTTATGGATTCTCTGGATTTACTAAAAAACTTGCTGATTCTCATACTCTAACTCCAAGA
  TCTTGCCCGTATGCTTCAGCAAGGCGAACACTTTTCTCAATGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001303120
• ORF Size: 255 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001303120.1, NP_001290049.1
• RefSeq Size: 329
• RefSeq ORF: 255
• Protein Families: Transmembrane
• Gene Summary: In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (KRTAP19-6-V2), which is produced by a polymorphic allele found in the alternate CHM1_1.1 and HuRef genome assemblies, differs at a single nucleotide position (reference SNP rs1023364) and contains a 1-nucleotide deletion (reference SNP rs5843453), resulting in a longer 3' coding region, compared to variant KRTAP19-6-V1. The encoded isoform (KRTAP19-6-V2) has a distinct and longer C-terminus, compared to isoform KRTAP19-6-V1.