LCE1C (NM_001276331) Human Untagged Clone

CAT#: SC333437

LCE1C (untagged) - Human late cornified envelope 1C (LCE1C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LCE1C
• Synonyms: LEP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276331, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTGCCAGCAGAGCCAGCAGCAGTGCCAGCCCCCTCCCAATGTCAGCTCCGGAGGCTGCTGTGGCT
  CCAGCTCTGGGGGCAGCTGTGGCTCCAGCTCTGGGGGATGCTGCAGTTCTGGGGGAGGTGGCTGCTGCCT
  GAGCCACCACAGGCGCCGTAGGTCCCACTGCCACAGACCCCAGAGCTCTGGCTGCTGCAGCCAGCCCTCG
  GGGGGCTCCAGCTGCTGTGGCGGGGGGAGTGGCCAGCACTCTGGAGGCTGCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276331
• ORF Size: 267 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001276331.1, NP_001263260.1
• RefSeq Size: 605
• RefSeq ORF: 267
• Locus ID: 353133
• Gene Summary: Precursors of the cornified envelope of the stratum corneum. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.