UBE2V1 (NM_001282578) Human Untagged Clone
CAT#: SC333449
UBE2V1 (untagged) - Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 16
"NM_001282578" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2V1 |
Synonyms | CIR1; CROC-1; CROC1; UBE2V; UEV-1; UEV1; UEV1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282578, the custom clone sequence may differ by one or more nucleotides
ATGACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAAGCACCCC CCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAATGGAGTGGTGGACCCAAG AGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATCAAAGTTGTCCTGCAAGAGCTTCGGCGC CTAATGATGTCTAAAGAAAATATGAAACTCCCTCAGCCGCCCGAAGGACAGTGTTACAGCAATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282578 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282578.2, NP_001269507.1 |
RefSeq Size | 2347 bp |
RefSeq ORF | 276 bp |
Locus ID | 7335 |
Cytogenetics | 20q13.13 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]' Transcript Variant: This variant (16) uses an alternate 5' exon structure, and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at an alternate AUG and result in an isoform (h) with a shorter and distinct N-terminus, compared to isoform a. Variants 12, 15, and 16 encode the same isoform (h). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235555 | UBE2V1 (myc-DDK-tagged) - Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 16 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review