TXNDC8 (NM_001286946) Human Untagged Clone

CAT#: SC333465

TXNDC8 (untagged) - Human thioredoxin domain containing 8 (spermatozoa) (TXNDC8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TXNDC8
• Synonyms: bA427L11.2; SPTRX-3; SPTRX3; TRX6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286946, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTACAGATTATTAAAGACACGAATGAATTTAAAACATTTTTGACAGCTGCCGGACACAAACTCGCAG
  TGGTTCAATTTTCTTCGAAACGGTGTGGTCCCTGCAAAAGGATGTTTCCTGTTTTCCATGAGCTGGCTGA
  AACTTGTCACATCAAAACAATACCCACATTTCAGATGTTCAAGAAAAGCCAGAAGGTAACCCTATTCTCA
  AGAATCAAAAGAATAATTTGCTGTTATAGAAGTGGATTCATGAGCAACCTGTGTCTTGCAGATGATGGAA
  ATGAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286946
• ORF Size: 288 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286946.1, NP_001273875.1
• RefSeq Size: 480
• RefSeq ORF: 288
• Locus ID: 255220
• Protein Families: Druggable Genome
• Gene Summary: May be required for post-translational modifications of proteins required for acrosomal biogenesis. May act by reducing disulfide bonds within the sperm. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## RefSeq Select criteria :: based on manual assertion, conservation, expression ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.