NDUFB6 (NM_001199987) Human Untagged Clone

CAT#: SC333473

NDUFB6 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (NDUFB6), transcript variant 3


  "NM_001199987" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFB6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFB6
Synonyms B17; CI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001199987, the custom clone sequence may differ by one or more nucleotides


ATGACGGGGTACACTCCGGATGAGAAACTGCGGCTGCAGCAGCTGCGAGAGCTGAGAAGGCGATGGCTGA
AGGACCAGGAGCTGAGCCCTCGGGAGCCGGTGCTGCCCCCACAGAAGATGGGGCCTATGGAGAAATTCTG
GAATAAATTTTTGGAGAATAAATCCCCTTGGAGGAAAATGGAAAAACCATATGGCATAGTTGAAAAGAAG
TCCAGAATATTCCCTGGTGATACAATTCTGGAGACTGGAGAAGTAATTCCACCAATGAAAGAATTTCCTG
ATCAACATCATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199987
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199987.1, NP_001186916.1
RefSeq Size 780 bp
RefSeq ORF 294 bp
Locus ID 4712
Cytogenetics 9p21.1
Protein Families Transmembrane
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing occurs at this locus and three transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jan 2011]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.