DYNLT1 (NM_001291602) Human Untagged Clone

CAT#: SC333485

DYNLT1 (untagged) - Human dynein, light chain, Tctex-type 1 (DYNLT1), transcript variant 2


  "NM_001291602" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DYNLT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DYNLT1
Synonyms CW-1; TCTEL1; tctex-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291602, the custom clone sequence may differ by one or more nucleotides


ATGGAAGACTACCAGGCTGCGGAGGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCA
AAGTGAACCAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCATT
TAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCAAGTTCCTGCTTC
TGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAGACCATGTACTGCATCGTCAGTG
CCTTCGGACTGTCTATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001291602
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291602.1, NP_001278531.1
RefSeq Size 746 bp
RefSeq ORF 300 bp
Locus ID 6993
Cytogenetics 6q25.3
Gene Summary 'This gene encodes a component of the motor complex, cytoplasmic dynein, which transports cellular cargo along microtubules in the cell. The encoded protein regulates the length of primary cilia which are sensory organelles found on the surface of cells. The protein encoded by this gene interacts with viral proteins, like the minor capsid protein L2 of human papillomavirus, and is required for dynein-mediated delivery of the viral nucleic acid to the host nucleus. This protein interacts with oncogenic nucleoporins to disrupt gene regulation and cause leukemic transformation. Pseudogenes of this gene are present on chromosomes 4 and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.