SFRS12 (SREK1) (NM_001270493) Human Untagged Clone

CAT#: SC333489

SREK1 (untagged) - Human splicing regulatory glutamine/lysine-rich protein 1 (SREK1), transcript variant 4


  "NM_001270493" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SREK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SREK1
Synonyms SFRS12; SRrp86; SRrp508
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001270493, the custom clone sequence may differ by one or more nucleotides


ATGAACAGCGGCGGCGGCTTCGGTTTGGGCTTAGGCTTCGGCCTCACCCCCACGTCGGTGATTCAGGTGA
CGAATCTGTCGTCGGCGGTGACCAGCGAGCAGATGCGGACGCTTTTTTCCTTCCTAGGAGAAATCGAGGA
GCTGCGGCTCTACCCCCCGGACAACGCACCTCTTGCTTTTTCCTCCAAAGTATGTTATGTTAAGTTTCGT
GATCCATCAAGTGTTGGCGTGGCCCAGCATCTAACTAACACGGTTTTTATTGACAGAGCTCTGATAGTTG
TTCCTTGTGCAGAAGATGACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270493
ORF Size 303 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270493.1, NP_001257422.1
RefSeq Size 2143
RefSeq ORF 303
Locus ID 140890
Gene Summary This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (4) lacks multiple exons in the 3' coding region and includes an alternate 3' terminal exon, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.