SFRS12 (SREK1) (NM_001270493) Human Untagged Clone

CAT#: SC333489

SREK1 (untagged) - Human splicing regulatory glutamine/lysine-rich protein 1 (SREK1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SREK1
• Synonyms: SFRS12; SRrp86; SRrp508
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270493, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACAGCGGCGGCGGCTTCGGTTTGGGCTTAGGCTTCGGCCTCACCCCCACGTCGGTGATTCAGGTGA
  CGAATCTGTCGTCGGCGGTGACCAGCGAGCAGATGCGGACGCTTTTTTCCTTCCTAGGAGAAATCGAGGA
  GCTGCGGCTCTACCCCCCGGACAACGCACCTCTTGCTTTTTCCTCCAAAGTATGTTATGTTAAGTTTCGT
  GATCCATCAAGTGTTGGCGTGGCCCAGCATCTAACTAACACGGTTTTTATTGACAGAGCTCTGATAGTTG
  TTCCTTGTGCAGAAGATGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270493
• ORF Size: 303 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270493.1, NP_001257422.1
• RefSeq Size: 2143
• RefSeq ORF: 303
• Locus ID: 140890
• Gene Summary: This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (4) lacks multiple exons in the 3' coding region and includes an alternate 3' terminal exon, compared to variant 1. The encoded isoform (d) has a distinct C-terminus and is shorter than isoform a.