alpha Defensin 1 (DEFA1B) (NM_001302265) Human Untagged Clone

CAT#: SC333495

DEFA1B (untagged) - Human defensin, alpha 1B (DEFA1B), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFA1B
• Synonyms: HNP-1; HP-1; HP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302265, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGATGGTGACCCCAGCCATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTGCAGG
  CCCAGGCTGAGCCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAGATTGCAGCGGACAT
  CCCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAGCTTGGCTCCAAAGCATCCAGGCTCAAGGAAAAAC
  ATGGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTATGGAACCTGCATCTACCAGG
  GAAGACTCTGGGCATTCTGCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302265
• ORF Size: 306 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001302265.1, NP_001289194.1
• RefSeq Size: 542
• RefSeq ORF: 306
• Locus ID: 728358
• Protein Families: Druggable Genome
• Gene Summary: Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).