CCDC103 (NM_001258398) Human Untagged Clone

CAT#: SC333516

CCDC103 (untagged) - Human coiled-coil domain containing 103 (CCDC103), transcript variant 5


  "NM_001258398" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCDC103"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCDC103
Synonyms CILD17; PR46b; SMH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001258398, the custom clone sequence may differ by one or more nucleotides


ATGGAAAGGAATGACATCATCAACTTCAAGGCTTTGGAGAAAGAGCTGCAGGCTGCACTCACTGCTGATG
AGAAGTACAAACGGGAGAATGCTGCCAAGTTACGGGCAGTGGAACAGAGGGTGGCTTCCTATGAGGAGTT
CAGGGGTATTGTCCTTGCATCACATCTGAAGCCACTGGAGCGGAAGGATAAGATGGGAGGAAAGAGAACT
GTGCCCTGGAACTGTCACACTATTCAGGGAAGGACCTTCCAGGATGTGGCCACTGAAATCTCCCCGGTAG
AAAGCCCCCCTCCAGCCCGAGACGTCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001258398
ORF Size 312 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001258398.1, NP_001245327.1
RefSeq Size 1751
RefSeq ORF 312
Locus ID 388389
Gene Summary This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR and in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.