GLIPR2 (NM_001287011) Human Untagged Clone

CAT#: SC333531

GLIPR2 (untagged) - Human GLI pathogenesis-related 2 (GLIPR2), transcript variant 3


  "NM_001287011" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GLIPR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GLIPR2
Synonyms C9orf19; GAPR-1; GAPR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287011, the custom clone sequence may differ by one or more nucleotides


ATGGGCAAGTCAGCTTCCAAACAGTTTCATAATGAGGTCCTGAAGGCCCACAATGAGTACCGGCAGAAGC
ACGGCGTCCCCCCACTGAAGCTCTGCAAGAACCTCAACCGGGAGGCTCAACAGTATTCTGAGGCCCTGGC
CAGCACGAGGATCCTCAAGCACAGCCCGGAGTCCAGCCGTGGCCAGTGTGGGGAGAACCTTGCATGGGCA
TCCTATGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTATAACTTCCAGC
AGCCTGGCTTCACCTCGGGGACTGGGGGTCTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287011
ORF Size 315 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001287011.1, NP_001273940.1
RefSeq Size 2245
RefSeq ORF 315
Locus ID 152007

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.