PPCS (NM_001287507) Human Untagged Clone
CAT#: SC333538
PPCS (untagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 4
"NM_001287507" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPCS |
Synonyms | CMD2C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287507, the custom clone sequence may differ by one or more nucleotides
ATGAAGATGGTGCCAAAACTGCTTTCTCCTTTGGTTAAAGATTGGGCTCCCAAAGCATTTATAATTTCCT TTAAGTTGGAGACTGACCCCGCCATTGTAATTAATCGAGCTCGGAAGGCTTTGGAAATTTATCAGCATCA AGTGGTGGTGGCTAATATCCTTGAGTCACGACAGTCCTTTGTGTTTATTGTAACCAAAGACTCGGAAACC AAGTTATTGCTATCAGAGGAAGAAATAGAAAAAGGCGTAGAGATAGAAGAGAAGATAGTGGATAATCTTC AGTCTCGACACACAGCTTTTATAGGTGACAGAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287507 |
ORF Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001287507.1, NP_001274436.1 |
RefSeq Size | 2108 |
RefSeq ORF | 318 |
Locus ID | 79717 |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis |
Gene Summary | Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCS (EC 6.3.2.5), one of the last enzymes in this pathway, converts phosphopantothenate to phosphopantothenoylcysteine (Daugherty et al., 2002 [PubMed 11923312]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (4) uses an alternate first exon and an alternate splice junction at the 3' end of the second exon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235644 | PPCS (myc-DDK-tagged) - Human phosphopantothenoylcysteine synthetase (PPCS), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review