KIR2DS2 (NM_001291700) Human Untagged Clone
CAT#: SC333551
KIR2DS2 (untagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2), transcript variant 4
"NM_001291700" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR2DS2 |
Synonyms | 183ActI; CD158b; CD158J; cl-49; KIR-2DS2; NKAT-5; NKAT5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291700, the custom clone sequence may differ by one or more nucleotides
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGG GAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCAAAACCGGTAACCCCAGACACCTGCA TGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGG TGCTCCAACAAAAAAAATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGG ATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291700 |
ORF Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001291700.1, NP_001278629.1 |
RefSeq Size | 979 |
RefSeq ORF | 321 |
Locus ID | 100132285 |
Gene Summary | Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene represents a haplotype-specific family member that encodes a protein with a short cytoplasmic tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (4) lacks two alternate in-frame exons that encompass parts of the 5' and central coding regions, compared to variant 1. The encoded isoform (d) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235657 | KIR2DS2 (myc-DDK-tagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review