C22orf25 (TANGO2) (NM_001283248) Human Untagged Clone
CAT#: SC333555
TANGO2 (untagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 12
"NM_001283248" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TANGO2 |
Synonyms | C22orf25; MECRCN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001283248, the custom clone sequence may differ by one or more nucleotides
ATGTGCATCATCTTCTTTAAGTTTGATCCTCGCCCTGTTTCCAAAAACGCGTACAGGCTCATCTTGGCAG CCAACAGGGATGAATTCTACAGCCGACCCTCCAAGTTAGCTGACTTCTGGGGGAACAACAACGAGATCCT CAGTGGGCTGGACATGGAGGAAGGCAAGGAAGGAGGCACATGGCTGGGCATCAGCACACGTGGCAAGCTG GCAGCACTCACCAACTACCTGCAGCCGCAGCTGGACTGGCAGGCCCGAGGGCGAGGCAGCTGCCAGACCC GGCCATCGAGGACCAGGGTGGGGAGTACGTGCAGCCCATGCTGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001283248 |
ORF Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001283248.2, NP_001270177.1 |
RefSeq Size | 3098 |
RefSeq ORF | 324 |
Locus ID | 128989 |
Gene Summary | This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235661 | TANGO2 (myc-DDK-tagged) - Human transport and golgi organization 2 homolog (Drosophila) (TANGO2), transcript variant 12 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review