JPT1 (NM_001288609) Human Untagged Clone

CAT#: SC333556

HN1 (untagged) - Human hematological and neurological expressed 1 (HN1), transcript variant 5


  "NM_001288609" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "JPT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol JPT1
Synonyms ARM2; HN1; HN1A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001288609, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCTAATATCTTTGGGACACCTGAAGAAAATCAAGCTTCTTGGGCCAAGTCAGCAGGTGCCAAGT
CTAGTGGTGGCAGGGAAGACTTGGAGTCATCTGGACTGCAGAGAAGGAACTCCTCTGAAGCAAGCTCCGG
AGACTTCTTAGATCTGAAGGGAGAAGGTGATATTCATGAAAATGTGGACACAGACTTGCCAGGCAGCCTG
GGGCAGAGTGAAGAGAAGCCCGTGCCTGCTGCGCCTGTGCCCAGCCCGGTGGCCCCGGCCCCAGTGCCAT
CCAGAAGAAATCCCCCTGGCGGCAAGTCCAGCCTCGTCTTGGGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288609
ORF Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001288609.1, NP_001275538.1
RefSeq Size 2294
RefSeq ORF 327
Locus ID 51155

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.