PGPEP1 (NM_001300927) Human Untagged Clone

CAT#: SC333580

PGPEP1 (untagged) - Human pyroglutamyl-peptidase I (PGPEP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGPEP1
• Synonyms: PAP-I; Pcp; PGI; PGP; PGP-I; PGPI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300927, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACCGTGAACGCCA
  GTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTGGACCTGCATGTGTACGAGAT
  TCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCCCTGTGGGAGAAGCACAGTCCACAGATATCT
  CTGCGACTTTACCTACTACACCTCTTTGTACCAGAGTCACGGTCGATCAGCCTTCGTCCACGTGCCCCCA
  CTGGGGAAGCCGTACAACGCGGACCAGCTGGGCAGGGCACTGAGAGCCATCATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300927
• ORF Size: 336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300927.1, NP_001287856.1
• RefSeq Size: 6862
• RefSeq ORF: 336
• Locus ID: 54858
• Protein Families: Druggable Genome, Protease
• Gene Summary: The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (2) lacks an alternate exon in the coding region, resulting in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.